Halal and Haram Issues in Food and Beverages Essay Example for Free

Halal and Haram Issues in Food and Beverages Essay Halal and Haram Issues in Food and Beverages In food industry, modern science and technology lead to creation of variety foods and beverages. The evolution comes together with booming of additives and ingredients to match with demands and perfections in food production. Different types of beverages as well as variety of foods offered in the market often confuse the consumers especially Muslims and most of them are unaware of what they have consumed. Generally Halal means clean and healthy food which has also being proven scientifically. In Islam, the consumption of Halal food and beverage and using Halal consumer products are obligatory in serving Allah, the Creator and the Almighty. Therefore, Muslims communities are very mindful of food ingredients, handling process and packaging of food products. The foods and beverages are only Halal if the raw materials and ingredients used are Halal and it is fully compatible to the Islamic guidelines. Nowadays, â€Å"Halal† oriented foods and beverages get food industry attention in all over the country as is expected to become a significant contributor to economic growth. It must be understood that the production of Halal food and beverage are not only beneficial to Muslims, but also to food producers, by means of increased market acceptance of their products. In food production, sugars are widely used as it could make the food and beverage taste sweet and delicious. There are many types of sugars such as glucose, fructose, lactose and maltose. A problem occurs as those sugars might transform to an alcohol named ethanol (or ethyl alcohol) by natural fermentation process which is not performed by enzymes. According to scientific review, both natural and manufactured products contain small amount of alcohol; for example, fruits, juices, vegetables, breads, cheeses, beef, and honey. Those food and beverage usually contain not more than 0. 5% of alcohol. Therefore, anything containing sugar is fermentable into alcohol. Other manufactured products such as Coca Cola, Pepsi, and Mirinda contain alcohol at percentage range of 0. 2% 0. 3% as Beta Carotene (the colouring used) is melted by using the alcohol method. In addition, according to Eastern Standard Time on July 8, 1999 (4:00 pm); â€Å"The oils that they use to make Pepsi have minute trace of alcohol which combined make up a percentage of alcohol. † The problem of alcohol that might contain in food or beverage has been debated by Mujamma’ Al-Fiqhi Al-Islami as certain types of alcohol are beneficial in food production. According to the Islam guidelines, Muslims are allow consuming ethanol as it is not harmful but only can be taken at small amount which is not more than the specified percentage.

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Abstract Objective: The therapeutic potential of cisplatin in ovarian cancer treatment is limited by the occurrence of cellular resistance. To explore the role of long non-coding RNA UCA1 in cisplatin induced ovarian cancer cell resistance. Methods: Twenty-four ovarian cancer tissues and sixteen normal tissues were used to assess the expression of UCA1 RNA. After expression UCA1 in SKOV3 cells, the cell migration, invasion and cisplatin resistance was assessed. Furthermore, the related mechanism was also explored. In addition, SRPK1 knockdown cell line was established and the effect of SRPK1 on cell migration, invasion and cisplatin resistance was also evaluated. Results: The increased expression of UCA1 RNA was identified in 24 ovarian cancer tissue compared with normal tissue. Expression of UCA1 RNA in SKOV3 cells increased the cell migration, invasion and cisplatin resistance. Alternated expression of SRPK1 and apoptosis related proteins were found in SKOV3/pcDNA-UCA1 cells. The effect of UCA1 expression on cell migration, invasion and cisplatin resistance was reversed by knocking-down SRPK1 in SKOV3 cells. Conclusions: Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA was extended through targeting SRPK1 and apoptosis related pathway. Key words: Long non-coding RNA, UCA1, SRPK1, cisplatin resistance, cell migration, invasion Introduction Ovarian cancer is the second most commonly diagnosed gynecological cancer in the world, and causes more deaths per year than any other the female reproductive system related cancer(1). More than 200,000 cases are newly diagnosed and 120,000 women die of ovarian cancer annually all over the world(2). Platinum based chemotherapy is active in ovarian cancer treatment. However, intrinsic or acquired cellular resistance to cisplatin is encountered regularly and severely limits the therapeutic potential of the drug(3). Multiple biological processes, such as dose accumulation, metabolism, apoptosis, DNA damage, are involved in the mechanisms of cellular resistance(4). Conquering cisplatin resistance remains therefore a critical goal for anticancer therapy and considerable efforts have been undertaken to solve this problem throughout the past three decades. Previous studies have shown that serine/arginine-rich protein-specific kinase 1(SRPK1) and apoptosis related protein are closely related with cisplatin resistance. SRPK1 is a kinase which belongs to SR kinase family (5). Through regulating the phosphorylation of SR splicing factors, SRPK1 can afftect the pre-mRNA splicing and consequently gene expression (6). Increasing attentions have been paid on the role of SRPK1 in cisplatin resistance(7-8). The apoptosis resistance induced by anticancer drug treatment has been suggested as another important mechanism in cellular resistance(4). More and more studies have shown that abnormal expression of long non-coding RNA (lncRNA) is involved in tumor development and progression(9). In a previous study, we obtained lncRNA UCA1 using RACE and found that higher expression of lncRNA UCA1 in bladder tumor tissues than normal tissues(10). Here, we tried to assess the expression of UCA1 and SRPK1 in ovarian cancer tissue and normal tissue using RT-PCR and explore the role of UCA1 in cisplatin induced ovarian cancer cell resistance. Our results might provide theoretical basis for chemotherapy selection in clinic and a novel cisplatin resistance related target was also suggested. Methods and materials Cell culture, Patients and Ovarian tumor specimens The human ovarian cancer cell line SKOV3 was maintained at 37 °C and 5% CO2 incubator in RPMI-1640 media with 10% fetal bovine serum, 100 U/ml penicillin, and 100  µg/ml streptomycin. Flash frozen tissue specimens (n= 40) were obtained from patients undergoing debulking surgery for ovarian cancer at People’s hospital of Shaanxi Providence, Shaanxi, China from January 2010 to January 2013. Among the specimens, epithelial ovarian cancer (n=24) were obtained from primary lesion of the patients without radiochemotherapy while normal ovarian samples (n= 16) were obtained from patients undergoing hysterectomies for benign conditions. The pathological examination on all tissues was confirmed by two experienced physician. Written consent was provided by each patient and the whole protocol was proved by the Review Board of the hospital. Reverse transcription PCR analysis Total RNA extraction of cancer tissue or cells were performed with Trizol (Life Tech, US) and the reverse transcription reaction were performed with ImProm II reverse transcriptase(Promega, US) according to the manufacturer’s instruction. UCA1, SRPK1, 18S rRNA specific sequences were amplified during 30 cycles of 30 s denaturing at 95 °C, 60 s annealing at 57 °C, and 60 s extension at 72 °C, with the primers listed in Table 1. Table 1 Primer sequences used in the study Name Forward primer Reverse primer UCA1 CTCTCCATTGGGTTCACCATTC GCGGCAGGTCTTAAGAGATGAG SRPK1 TAACGGACCACTGGACAACAAA TTCCTGCGACCACTCATACTTC 18S rRNA CAGCCACCCGAGATTGAGCA TAGTAGCGACGGGCGGTGTG UCA1 (full length) CGGGATCCTGACATTCTTCTGGACAATGAG CCGGAATTCGCATATTAGCTTTAATGTAGGTGGC Expression of UCA1 in SKOV3 cells The full length of UCA1 was expanded by PCR (The primer was showed in Table 1) at an annealing temperature of 53  °C. After digested with BamHI and EcoRI, the PCR fragment was subcloned into pcDNA3.1 to construct the pcDNA-UCA plasmid. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US). Twenty-four hours later, G418 selection(500  µg/mL) was processed for 3 weeks. The characterization of the positive clone was confimed by RT-PCR. The pcDNA3.1 without UCA1 fragment was used as negative control. RNAi The shRNA sequences of SRPK1 were obtained according to previous description(11). SH1 and SH3, encoding shRNA targeting nucleotides 1423 to 1443 (GGTCAGTCATTCAGTGAACAA) and 288 to 308 (CAAGAAGATCCTAATGATTA), respectively, of the SRPK1 mRNA, were processed with annealing, subcloning into PRNAT-U6.1/Neo plasmid (GenScrpt Corp., Piscataway, NJ, US), plasmid expansion and media amount extraction. Transient transfection of cells with plasmid was performed with Lipofectamine ® 2000 (Life Tech, US) and 3 different batch of cells were used for knockdown efficacy examination. Stable cell lines were obtained by G418 selection for 3 weeks. The expression of SRPK1 was confirmed by western-blot analysis. Western-blot analysis The frozen myocardial tissues were lysed in RIPA buffer (Beyotime, China), followed by high speed centrifugation and BCA quantification. Cellular protein was separated by electrophoresis on SDS-PAGE gel and then transferred onto PVDF membrane. After blocking, the blots were incubated with the antibodies to SRPK1 (BD), Bcl-2 (Cell Signaling Technology), BAX (Cell Signaling Technology), caspase-3(Cell Signaling Technology), aspase-3(Cell Signaling Technology). And ÃŽ ²-Actin(Cell Signaling Technology) was used as loading control. The appropriate HPR conjugated secondary antibodies were applied. The protein bands detected with SuperSignal Ultra Chemiluminescent Substrate (Pierce) on X-ray films (Koda). MTT After preparing the single cell suspension, 4Ãâ€"103 cells in 100 ÃŽ ¼L culture media were seeded in 96-well plate in quadruplicate overnight. MTT was added for 4 hr, and formazan dye was dissolved with DMSO and read at 490 nm in a microplate reader (Molecular Device, US). All the experiments were performed for three times. Clonogenic Survival Assay Cells (5Ãâ€"102) were seeded in 6-well plates overnight and incubated with RPMI1640 + 10%FBS + 500 ÃŽ ¼g/ml G418 for 14 day. After removing the media, cells were washed with PBS, fixed with 95% ethanol for 30 min and stained with Giemsa for 15 min. Colonies with >50 cells were counted under microscope. Percentage cell survival is expressed relative to untreated control. Scratch assay 3.0Ãâ€"105 cells were seeded in 6-well plates and the cells were allowed to grow until 90% confluence was reached. Then the cells were grown in 0.2% FBS RPMI1640 media overnight for resting and a scratch was made by using the 200 ÃŽ ¼L pipette tip. The photos were taken at 0 h and 24 h under a microscopy and the relative migrating distances of the wound areas were measured on the images. 3-D migration and Invasion assay Cells (5Ãâ€"105) were seeded in triplicate in upper chamber of the Millicell (8 ÃŽ ¼m pore diameter) which was pre-coated with Matrigel (Becton Dickinson Labware, Bedford, MA). After the lower chamber of the Millicell was added with 900 ÃŽ ¼L RPMI 1640 +20% FBS, the Millicell was incubated at 37 °C and 5% CO2 for 24 hrs. Then the Matrigel was removed by cotton tip, fixed with 95% ethanol for 30 min, stained with Giemsa staining. The membrane was checked with microscopy. The migration assay was similar with invasion assay but with 12 hr incubation time. Cisplatin resistance assay Cells (3Ãâ€"104) were seeded in quadruplicate in 24-well plate and allowed to adhere overnight. Then the cells were treated with serious concentration of cisplatin(0,2.5,5,10, 20,40,80 ÃŽ ¼M) for 48 hr. Cell viability was determined by MTT assay at 490 nm wavelength. Statistical analysis All statistical analyses were performed using the SPSS13.0 software. The results were presented as means  ± SD. Two-tailed Student’s t-test was used to examine the differences between groups. P Results The expression of UCA 1 RNA and SRPK1 mRNA in ovarian tissues Twenty-four ovarian epithelial cancer tissue and sixteen normal ovarian tissue was used to assess the UCA1 and SRPK1 expression. And we found higher expression of UCA 1 RNA and SRPK1 mRNA in ovarian cancer tissue while no significant expression of UCA1 and SRPK1 was found in normal ovarian tissue(Figure 1A). The effect of UCA1 RNA expression on SKVO3 migration and invasion Cell lines establishing After constructing of pcDNA-UCA1, the stable cell lines with or without UCA1 RNA expression were established. The positive control was confirmed by RT-PCR and the result showed that a length of 1442 bp UCA1 RNA was expanded from SKOV3/pcDNA-UCA1 while no UCA1 was found in negative control SKOV3/pcDNA 3.1(Figure 1B). 2-D and 3-D Migration and invasion assay The scratch assay suggested that cell migration ability of SKOV3/pcDNA-UCA1 was significantly increased that of SKOV3/pcDNA 3.1(Figure 1C). The 3-D migration and invasion assay with millicell chamber showed that the migration and invasion abilities were significantly increased in SKOV3/pcDNA-UCA1 cell than SKOV3/pcDNA 3.1 cells(Figure 2A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pcDNA-UCA1 cell. The IC50 of SKOV3/pcDNA-UCA1 cells increased 2.41 times than that of SKOV3/pcDNA 3.1 cells(Figure 2B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 and SKOV3/pcDNA 3.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pcDNA-UCA1 cells (Figure 2C). The effect of SRPK1 knockdown on SKOV3 cells Knockdown cell line establishing The knockdown efficacy of pRNAT-SH1 and pRNAT-SH3 were firstly examined by transient transfestion and western-blot. And the results showed that SKOV3/ pRNAT-SH3 was extend a better effect of knocking down SRPK1 (Figure 3A1). Stable cell lines of SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 were also established and the effect of pRNAT-SH3 on SRPK1 knockdown was showed in Figure 3A2. The proliferation, colongenic, migration, invasion abilities of SRPK1 knockdown The result of MTT assay was showed that decreased proliferation was found in SKOV3/pRNAT-SH3(Figure 3B). The colongenic ability of SKOV3/pRNAT-SH3 was significantly decreased than that of SKOV3/pRNAT-U6.1(Figure 3C). The 3-D migration and cell invasion assay showed that the cell migration and invasion were decreased in SKOV3/pRNAT-SH3 cells than SKOV3/pRNAT-U6.1 cells(Figure 4A). Cisplatin resistance assay The cisplatin resistance assay was performed with SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells by MTT. Increased cisplatin resistance was found in SKOV3/pRNAT-SH3 cell. The IC50 of SKOV3/pRNAT-SH3 cells was increased 2.64 times than that of SKOV3/pRNAT-U6.1 cells(Figure 4B). Western blot analysis of SRPK1 and apoptosis pathway To explore the mechanism we analyzed the expression of SRPK1, Bcl-2, Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 and SKOV3/pRNAT-U6.1 cells and found that increased expression of SRPK1 and Bcl-2 and decreased expression of Bax, Caspase3 and Caspase9 in SKOV3/pRNAT-SH3 cells (Figure 4C). Discussion The lnc RNA UCA1 was cloned in our lab using SMAT-RACE from the bladder cancer cell line BLZ-211. And UCA1 RNA showed an expression pattern of increasing expression in early stage of human embryonic development, differential expression at 28 week of embryonic development, no expression in normal adult tissues. However, the expression of UCA1 RNA was increased in bladder cancer tissues(10). In addition, the increasing expression of UCA1 RNA than the normal or para-carcinoma tissueswas also found in breast cancer, liver cancer, thyroid cancer, cervical cancer, lung cancer, esophagus cancer, gastric cancer and so on(12). We didn’t observe an obvious expression of UCA1 RNA in normal tissues and did observe the expression of UCA1 RNA in ovarian cancer tissues. This suggested UCA1 RNA may extent a critical role in the development and progression of ovarian cancer. The previous study showed that the abilities of cell proliferation, cisplatin resistance, invasion and migration were increased in bladder cancer cell line(13). Yang et al showed that UCA1 can regulate the cell cycle through CREB and PI3K pathway(14). Wang et al found that overexpression of UCA1a(also named as CUDR) in bladder cancer cells would increase the abilities of cell proliferation, invasion and cisplatin resistance and decrease cell apoptosis(15). Wing et al showed that increased expression of UCA1a could increase the cellular resistance and decrease the apoptosis in A431 squamous cancer cells. However, the mechanism is still unknown(16). The cisplatin resistance of ovarian cancer is the main cause of tumor recurrence and the failure of chemotherapy. The mechanisms of cisplatin resistance included dose accumulation of the drug, metabolism, apoptosis and DNA damage and it is a complicate process of multi-factor, multi-level and multi-gene. SKOV3 was used to assess the cisplatin resistance effect in ovarian cancer. We established SKOV3 cell lines expressing UCA1 RNA and found that cell abilities of migration, invasion and cisplatin resistance were increased, which was consistent with the results obtained from the bladder cancer cell lines. Since SRPK1 was proved to involve in the cisplatin resistance(17-18), we also tried to analyze the association between UCA1 RNA and SRPK1. And the western blot results showed that increased expression of SRPK1 and Bcl-2 while decreased expression of Bax, Caspase 3 and Caspase 9. SRPK1 is specific kinase belonged to SR family. It can specifically phosphorylate the SR splice factor and regulate the gene expression by alternative splicing of pre-mRNA of target gene(6). Hayes et al found decreased expression of SRPK1 in pancreas, colon and breast cancer could lead to increasing and decreasing expression of Bcl-2 and Bax. The decreasing on cell proliferation and increasing on cell apoptosis were found (19). Furthermore, increased sensitivities of Gemcitabine and Cisplatin were also found (11, 19). In order to confirm whether SRPK1 is involved in the mechanism of UCA1 regulating ovarian cancer proliferation and migration, we employed RNAi to decrease the expression of SRPK1 and found that increased expression of Bcl-2 and decreased expression of Bax, Caspase 3 and Caspase 9 after downregulating the expression of SRPK1. In addition, we found the increasing abilities on cell proliferation, migration and invasion after SRPK1 knockdown. In conclusion, we found UCA1 RNA may increasing of cell proliferation, decreasing apoptosis and lead to the cisplatin resistance by increasing the expression of SRPK1 and affecting the expression of apoptosis related proteins(such as Bcl-2, Bax, Caspase 3 and Caspase 9). Our results will add novel insight on cisplatin resistance and provide novel molecular target to the treatment.

Leadership in Tata Group

Leadership in Tata Group Introduction: Leadership is integrated part of our life. According to corporate chief and former US presidential candidate Ross Perot, the principles of leadership are timeless because, in a rapidly changing world, human nature remains a constant. We all experience leadership in our life from early childhood in our families, through friendships, social, recreational and sports activities, school and higher education, to politics and government, and, of course, in our work, we all recognize leadership in other people and often in ourselves. In government, global corporations and small businesses alike, the leadership role is becoming more demanding, more open to scrutiny and more difficult [Roger Gill]. The development of leadership theory also parallels the development of organizational theory. The bureaucratic form of organization is characterized by laissez-faire leadership whereby so-called leaders tend to avoid taking a stand, ignore problems, not follow up, and refrain from intervening or transactional leadership, in which leaders practise management by exception, focusing only on deviations from what is required, and contingent reward, rewarding people (either materially or psychologically) for achieving what is required. The emergence of the post-bureaucratic form of organization in the late nineteenth century reflects the development of the concept of transformational leadership. Theory Approaches to Leadership: Number of Leadership theories and approaches has been evolved on the basis of Style, Trait, Behavioural, Transformational, Situational and Charisma. Many researchers made efforts linking some of the theories across these leadership approaches. But each model has its own pros, cons, assumptions and limitations. Latest researches are conducted on Situational Transformational leadership styles. Leadership gurus presented new models as variations to the already existing models. Max Weber, MacGregor, Bernard Bass, Warren Bennis Nanus are few important researchers in the area of transformational leadership. Understanding the difference between transactional and transformational leadership is vital in getting the whole concept of transformational leadership theory. In general, a relationship between two people is based on the level of exchange they have. Exchange need not be money or material; it can be anything. The more exchange they have the more stronger the relation. Managers expects more productivity from employee in order to give good rewards. In this way, if something is done to anyone based on the return then that relation is called as Transactional type. In business, leaders announces rewards in turn to the productivity. These relations are all about requirements, conditions and rewards. In life, at one point of time, things happen without expectation from other side. Say, moms dedicated service to her kid. Mom doesnt expect anything from the child and the service she provides in raising the child is  unconditional, dedicated, committed. Mom plays a major role in shaping up the kids future life. This type of relation is called as Transformational. Leaders do exist in this world with these behaviours. Transformational Leaders wo rk toward a common goal with followers; put followers in front and develop them; take followers to next level; inspire followers to transcend their own self-interests in achieving superior results. Leadership Approach in TATA Group: TATA Group founded in 1868, is an Indian multinational conglomerate headquartered in the Mumbai, India. The Group has 500,000 employees spread over six continents (more than 80 countries). TATA Group current market capitalization is worth $80bn and is the largest private corporate group in India. TATA Group is biggest employer in UK, employing more than 50,000 people. TATA Group has interests in communications, IT, engineering, materials, services, energy, consumer products and chemicals. Its chairman, Ratan Tata is one of Indias and the worlds most influential person right now. The Tata Group is known for its good business ethics and corporate governance. TATA Groups leadership development programme aims at grooming the managers of today into the leaders of tomorrow. The leadership development programme conceived by JRD Tata, the late chairman of TATA group in 1950s. The idea behind the leadership programme known as Tata Administrative Services (TAS) was to select and groom young managers, provide them opportunity for professional growth, and make them leaders of tomorrow. This is TATAs in-house programme and has goal is to provide training to high performers, act as a cradle of change and develop the leadership qualities. Most of the TATA Group companies are traditionally led by these groomed leaders. The Group leadership style has been quite consistent from its existence since 1868. The Group has incorporated some more leadership changes which are essential in current century to drive towards more competitive. In terms of leadership style, TATA Group has adopted a team-led culture. With Ratan as a leader, the management style of the entire TATA Group has changed; trust became a huge facet and theme of the group. Ratan Tata has put a complete organisational restructuring when he took over by taking a more matrix-style approach building teams. These changes would have obviously transformed a lot in the business, senior managers would have had to be on their toes and flexibility and adaptability became essential qualities to have. The leadership changed from a centralised, command centre to a much more distributed form with employees and all managers enjoying greater responsibility and knowledge about the Group, which would have in turn; motivated them to work harder and as a group. From distinctive leadership models available such as the McGregor Theory X and Y; where a theory X manager believes workers dislike work, are not creative and avoid all responsibility while a theory Y manager believes that workers get as much enjoyment from work as they can derive with leisure, accept responsibility and are creative; it can be seen from this, that Ratan wanted all his managers to be modelled as closely to Theory Y and he himself could be called a Theory Y manager. He encouraged managers to be innovative and share all their ideas, consulting actively with them and giving them more responsibility and importantly encouraged team-working. Five Factor Model (Big Five): Emotional Stability: Ratan Tata has very low anxiety within him and has great sense of security with his future leadership. Extraversion: Even being a bachelor Ratan Tata is very sociable. He has produced very positive affect on future leadership of TATA Group. Openness: He believes in originality and versatility. By making  £1200/- car he has shown his great interest with and innovation seeking personality. Agreeableness: Within his management team Ratan Tata is well trusted and very friendly. Conscientiousness: He is very dutifulness. He spent most of his life working for TATA Group without any self-interest. He is very well organised as well. Style (Behaviour) Theory in TATA Group: As per style theory, there are three types of leadership models are evident in leadership. These are as follows. Autocratic Democratic Laissez-faire Ratan Tata is a leader who engages more democratic style of leadership approach. However at previous occasion has used other two kind of style as well. He is more democratic because he always encourages his group leadership to be creating good communication and participation. Future leadership are well informed about future strategy and they are very well engaged in decision making process. Most of the group long-term and short-term strategies are formulated by the lower rank of the leadership. They are treated as stake holders. Until now TATA Group has got leadership within them. Ratan Tata has occasionally shown some form of autocratic style of leadership. Sometimes when needed especially when quick and informed decisions have to be taken, but he is never too commanding in his nature, being a man of few words and being more of a man of action, this is evident from the manner he aggressively pushes for bold international deals, such as during the global acquisitions of business powe rhouses such as Corus, Jaguar and Land Rover, and Tetley Tea. One of his senior leadership team member, Muthuraman( Executive Director) refers him Ratan was the chief architect of the Corus deal. I was worried about the magnitude and the amount of money. But he instilled confidence. In daily routine matters and in developing the leadership, Ratan Tata also uses facets of the Laissez-Faire model such as the delegation of important duties and decision-making, he also does not in any way interfere with any managers functioning, he might make a broad strategic assessment but he does not interfere in operational issues and details, this shows that he has complete trust and faith in his managers and believes in their ability, this quote from Gopalakrishnan, an executive director of the company, shows how much value Ratan Tata places on his trust, this can be highly motivating for managers and workers alike, I remember what Ratan told us at a meeting. He said that he will continue to trust all his managers, but once they lose that trust, he will go after them. I think that is a very fair deal. Max Webers Leadership Model in TATA Group: Looking at Max Webers Transactional and Transformational Leadership models, where a leader is classed in three forms which are Bureaucratic, Charismatic and Traditional, where a bureaucratic leader is one who is always bound by the set rule and does not want to go beyond them; a Traditional leader is one who does and follows everything from a long past or history and always loyally obeys these traditions; a Charismatic leader is one who uses his own laurels or abilities to inspire and is one who can be described as radically opposed to administrative rules and legal principles. From these models, Ratan Tata falls into the Charismatic form because he is one who leads by example, coming up with highly innovative ideas such as  £1200 (Rs. One Lakh) car the Nano, budget hotels or low-end watches, he brought radical change to the Tata Group as a whole, changing it from its Traditional mindset to new more flexible and adaptive cultural mindset. Bennis Nanus Transformational Leadership Model in TATA Group: We can see from Bennis and Nanuss Transformational Leadership model that the transformational leaders groom their followers into self-empowered leaders and their main focus is to articulate vision and values clearly so the newly self-empowered leaders know where to go. Their traits include logical thinking, persistence, empowerment and self-control. Benniss and Nanus has evolved the model which emphasis on the four Is of Transformational leadership, which are Idealised Influence (being a role model) Inspirational Motivation (creating a team spirit, motivating and provide a challenge) Intellectual Stimulation (innovation and creativity) Individual Consideration (mentoring and providing support for followers) Ratan Tata, Chairman of the TATA Group has been proved a true transformational leader. We can see all Is built-in in Ratan Tata. He is the leader with great vision hence he knows right approach to groom future leadership. He has implemented the team spirit in whole group at every level. He empowers all his managers and executives and has complete faith in them, he is extremely innovative and is credited for much of the Groups new products, he places a great deal of importance to his RD department and he definitely cares deeply about the welfare of all his employees and managers. During the Mumbais terrorist attack in Taj Hotel, he took front line in leading at the time of crises. In his vision statement he articulated One hundred years from now, I expect TATA Group to be much bigger, of course, than it is now. More importantly, I hope the Group comes to be regarded as being the best in India. Best in the Manner in which we operate, best in the products we deliver and best in our valu e system and ethics. Having said that, I hope that a hundred years from now we will spread our wings far beyond India, that we become a global group, operating in many countries, as Indian business conglomerate that is at home in the world, carrying the same set of trust as we do today. As a leader of a global business group, Ratan Tata knows the fierce competition experienced by his business empire. He makes all effort to make his business competitive at global level. Through transformational leadership process TATA Group has made their processes and technology up to date. Once Ratan Tata said to his managers in his vision speech A company or business which remains static is a business that will die; a company that constantly changes and accepts that there are better ways to do things than the way they are done today, is a company that will survive in the global market that we face. From this statement we can infer that he knows the importance of developing a good leadership within group to take TATA Group to new heights. Ratan Tata involves strategy in leadership. He is a deep thinker and a brilliant strategist as is described by one of his Executive Directors, Alan Rosling, He is a deep thinker and extremely strategic. He is always 2-3 steps ahead. Ratan Tata is a man of strong integrity, ethics and valued principles. He cultivated the same across the TATA Group companies. One of his companies CEO said Tata has shown that there is no other way he will do business other than do it ethically. He believes in strong value based leadership approach in doing business. Ratan Tata has led the TATA Group to transforming from local business group to become a global leader. Conclusions: Ratan Tata of the Tata Group is a more kind of transformational leader. He made Tata Group as global brand. He has provided inspiration to leaders within his own company. In Tata Group leaders are engaged in decision making at every level. Ratan Tata has successfully lead and motivated its CEO/MD of the group companies to be ambitious. He has always adopted a ethical approach in group business. Appendix: Reference List Roger Gill, Theory and Practice of Leadership, Sage Publication, 2006 http://leadershipchamps.wordpress.com/2008/08/04/transactional-leadership-vs-transformational-leadership/ John P. Kotter, A Force For Change: How Leadership Differs From Management (New York: The Free Press, 1990). OTool, James.  Leadership from A to Z: A Guide for the Appropriately Ambitious, San Francisco: Jossey-Bass, 1999.   Visionary Leadership: Creating a Compelling Sense of Direction for Your Organization (Jossey Bass Business and Management Series): Burt Nanus Tata Steel Group Annual Reports (2005-06, 2006-07, 2007-08, 2008-09, 2009-10) Sometimes referred to as the chairmens chairman, JRD adopted a management by consensus style: When a number of persons are involved I am definitely a consensus man, he once said, adding: but that does not mean that I do not disagree or that I do not express my views. Basically it is a question of having to deal with individual men heading different enterprises. You have to adapt yourself to their ways and deal accordingly and draw out the best in each man. If I have any merit it is getting on with individuals according to their ways and characteristics. In fifty years I have dealt with a hundred top directors and I have got on with all of them. At times it involves suppressing yourself. It is painful but necessary. To be a leader you have got to lead human beings with affection. Be that as it may, Tata spotted talent easily. And once he was confident that a manager would perform, he gave him (alas, no women) a long rope. If they wanted to be on their own, like Sumant Moolgaokar, he left them to it. If they occasionally wanted a shoulder to cry on, like Darbari Seth, JRD was there.

Stuff about the bomb Essay examples -- essays research papers

The Most Difficult Decision Ever President Truman stood in the oval office full of many advisors, but was truly alone ready to make the hardest decision, which would change the world forever. Is dropping the bomb the right decision for the president to make? Dropping the bomb wasn't the right decision to make, because many people lost their lives and it wasn't right to make that move. On December 7, 1941 the Japanese bombed Pearl Harbor and on December 8, 1941 the president of the United States asked the congress to declare war on Japan. That’s what made the United States enter the war. When they attacked at that day, the Japanese destroyed 5 battle ships and another 19 ships. The United States kept fighting with Japan until 1945 and many Americans lost their lives while fighting for the different islands. The military leaders in America knew that this fighting will be for a long time and there will be more death, so they start striking them with long-range B-29 bombs. They even stroked on the Japanese main land in Tokyo March 1945. The president Truman was informed from the physicist J. Robert Oppenheimer and other scientists that the atomic bomb was ready to be use. First of all, Truman and his secretary of war Stimson thought it was better to use the atomic bomb to end the war quickly, and to stop the soldiers and people from getting killed. Truman got advises from many American military leaders. They told him that it would be better if he uses it on the Japanese main l...

Megans Law Essay -- essays research papers

In July of 1994, a little girl named, Megan Kanka, was raped and strangled. They found her body near her home in Hamilton Township, New Jersey. The story of thing young girl has shocked the nation. The man responsible for this brutal act is named, Jesse Timmendequas. He had been convicted twice prior to this attack. He also served six years in a treatment facility and had been released. Many people said that he was a quiet man, and this left them to think he was harmless. Unfortunately, this wasn’t the case. This sex offender lived in the same town, as a matter of fact, he lived across the street from the Kanka family. This man was not ready to be released at all. In fact, he shouldn’t have been released. This only left him more of an opportunity to stike again. This information brought the people of Hamilton Township to pass around a petition. The petition stated that a state law be passed informing the citizens of their community that such people live amongst them. This isn’t a rare request. In fact, there have been numerous attempts to bring this law into affect. This should have been done from the beginning, but some people actually think these sex offenders have rights. Well, the people of Hamilton Township didn’t agree. They felt that they should have been told that this sex offender lived within their neighborhood. "The real issue isn’t that the people of Hamilton Township were denied information on this sex offender, but why was this man released after only six...

Regenerative Battery For Human Electric Hybrid Bicycle Engineering Essay

In this study, a proposed undertaking, the human-electric intercrossed bike, besides known as â€Å" Pedelec † driven chiefly by human bicycling force with extra aid force from the battery powered electric motor that has a regenerative power characteristic during worsening inclines.IntroductionCars have ever been indispensable for people populating in metropoliss as a signifier of transit to transport out their day-to-day modus operandi. Harmonizing to the International Organization of Motor Vehicle Manufacturers, a astonishing figure of 77,609,901 autos and commercial vehicles were produced in the twelvemonth 2010. A 25.8 per centum alteration comparison to the old twelvemonth ( OICA, 2011 ) . Based on a research study of the Fifth U.S. Climate Action Report, transit activities contribute 33 per centum of the universe ‘s emanation of C dioxide in 2007 and about up to sixty per centum of emanation came from the burning of crude oil from personal transit ( U.S. Climate Ac tion Report, 2010 ) . Consequently, it is without uncertainty, autos are one of the major causes of planetary warming due to the emanation of green house gasses. Presently, intercrossed and electrical vehicles seems to be the leading solution to counter the job that arises from gasoline powered cars without extinguishing its advantages. However, electrical powered vehicles have its ain disadvantages as it requires a certain sum of bear downing clip. On the other manus, electric bike are doing immense moving ridges among town communities because it is less strenuous comparison to the standard bike, therefore, enable users to go longer distance without utilizing much energy. Amount of clip needed for bear downing still arises in electric bikes. The Regenerative Battery for Pedelecs on worsening terrains is able to work out the job by enabling the user to automatically bear down the bike battery during declivitous inclines.Literature ReviewElectric bike, Hybrid Bicycle and Human-Electr ic Bicycles or Pedelecs have merely late go a world-wide phenomenon due to the rise in crude oil monetary values. The engineering of these types of bikes is still comparative new and research popularity has simply get downing to lift in the past recent old ages. Therefore, there is deficiency of research documents and literature available in the country of intercrossed or electric bike in scholarly diaries or professional organisation such as the IEEE. The undermentioned literature reappraisal evaluates on eleven scholarly diaries to clarify the engineering involved in developing electric, Hybrid or Pedelecs bikes and its public presentation features. Among the 11 diaries included, a study by Muetze and Tan ( 2007 ) gave a elaborate and organized study based on the word picture of electric bike, both theoretically and by experimentation. The study includes every bit good the demands of different public presentations ideal for electric bikes and obstructions faced to back it. Regulations and safety factors for electrics bikes in states such as Japan, Europe, China and United States are outlined. Research was done to detect the advantages and disadvantages of proficient public presentations for different portion type of the bikes such as the aid type, motor, motor assembly, motor arrangement, accelerator and battery type. The study besides includes a power over velocity graph collected from consequences collected with different parametric quantities such as the influence of weight, influence of the incline and influence of air current. Consequences gathered from the study is able to supply a guideline for developing an electric bike suitable for the market tendency and better the public presentations of electric bikes for future developments. While the appraisal on the public presentation of electric bike is indispensable, energy direction excessively must be given consideration. Morchin ( 1998 ) identifies the energy consumed by electric bike and emanation of green houses gasses can be reduced by two methods. Such facets can be achieved by optimising the evaluations of the battery and engine while presenting power end product by each beginning under expected drive conditions ( Morchin, 1998 ) . In the study, an on-board â€Å" energy director † was mounted on an electric bike to track the energy degree in the battery and efficaciously split tonss between the battery and the engine. The Langrange ‘s theorem was used to cipher the energy consumed under impacting parametric quantities of air retarding force, hill inclines and clash. However, the survey done merely applies to electric powered bikes and non for intercrossed bikes or Pedelecs. Research can be done to widen for assorted types of bikes and different type of terrains. The term â€Å" intercrossed † used in the paper is instead deceptive because the paper focuses on to the full electric bike while the term â€Å" intercrossed bike † frequently refers a bike that runs on both crude oil gas and electricity or human pedal force with a battery powered motor. In a related research on power direction in electric aided bike, Brand and Ertugrul ( 2007 ) examines and discover that an in-hub direct thrust located on the front wheel of the bike could give better public presentation by electric braking and stable manoeuvring. Furthermore, the study conducted experiments on 17 riders from different classs. All riders are equally divided based on gender, weight, age, regular and irregular bicycler. The study is comprehensive and able to confirm the effectivity of the in-hub direct thrust. Additionally, the study dressed ore on measuring siting conditions of assorted type of rider group to find the optimal power demand and does no focal points on planing an option for electric bikes. It is noted in the study that aerodynamic streamlining and development of a high efficiency inverter can be a farther developed from the study. Most of the survey done about electric bikes revolves around the battery storage system. Solutions may compromise of electric regeneration ( Liu et al. , 2008 ) ; ( Somchaiwong & A ; Ponglangka, 2006 ) , or petroleum-electric bike ( Nagendran & A ; Senthil, 2010 ) ; ( Xiong, et al. , 2010 ) . Liu, et al. , ( 2008 ) designed four regenerative braking schemes by turning mechanical energy into electrical energy to widen the battery life-span. Matlab and Simulink were used to make a theoretical account of the electric motorcycle and the four proposed regenerative braking schemes. The four braking control schemes are Most Feedback Power ( MFP ) , Most System Efficiency ( MSE ) , Fixed Torque Control Strategy ( FTC ) and Fixed Feedback Current Control ( FFC ) ( Liu, et al. , 2008 ) . Clear description and illustration were given on all the four purposed schemes. The study illustrates theoretically utilizing computing machine simulations and there were no paradigm physique or practical expe riment conducted with bike users. Alternatively, Somchaiwong and Ponglangka ( 2006 ) proposed a regenerative power control system to work out the increase of rhythm velocity of motor that are excess for illustration, during a declivitous way. The research experiments on the relationship between the electromotive forces supplied and motor velocity. The consequence shows that if the rhythm motor runs on the specific velocity demand, the motor would in bend generate a specific end product electromotive force. Another prevailing solution battery jobs faced in electric bikes are petroleum-electric intercrossed bikes. Nagendran and Senthil ( 2010 ) proposed a Hybrid Bicycle with Three Speed Transmission System to work out jobs faces in current electric bikes. The purposed thought of the intercrossed bike tallies on both electric and crude oil to reload the bike ‘s battery storage system. An added characteristic to the purposed thought is a three velocity cogwheel for effectual control the velocity of the motor and IC ( Internal Combustion ) engine. The bike runs like an ordinary electric bike on Phase One. When the battery storage system is depleted, the motor would so runs on the internal burning engine. A Change Over is installed to link and disconnects the motor from the IC engine or vice-versa. A shaft coupling is used to link the concatenation thrust while a concatenation thrust is used to obtain balance of the bike. The research does non exemplify the practical building of the th ree velocity transmittal system. In a related subject, Liu, et al. , designed a LPG ( Liqufied Petroleum Gas ) – electric intercrossed bike that is able to run on to the full engine driven, to the full electric motor driven or intercrossed manner. Due to infinite restriction in the bike a four-stroke flicker ignition LPG engine power system is introduced in the research. The gasolene engine was modified into a LPG engine by increasing the compaction ratio, enlarging the flicker progress angle and increasing the ignition energy. The research besides includes the design of the transmittal system and control system of the intercrossed bike. A paradigm of the design was developed and several trials were conducted on metropolis traffic conditions. While most surveies focuses on a individual bike type such as electric bike or Pedelecs, Indulal & A ; Nair ( 2007 ) incorporates both types of bike and the execution of Fuzzy Logic as a control system. The bike runs on three different manners, Manual Mode, Power Mode and Automatic Mode. Manual Mode works like an ordinary where pedalling is required with no excess aid. Power Mode to the full runs on electricity and does non necessitate any paddling while Automatic Mode provides electric aid on top of manual pedalling. Fuzzy Logic is implemented to supply comfy equitation and sufficient thrust aid under any conditions. After the completion of the design, arrays of inputs were fed to the Fuzzy Logic Controller utilizing Matlab Simulation to analyze the end products. Consequences from the simulation found that the public presentation of the system over assorted conditions were acceptable. The research states that the design can be farther extended into larger vehicles. To optimise the potency of battery storage system, Sousa, et al. , ( 2007 ) developed an electronic convertor powered by two type power supplies, the battery and ace capacitances. Batteries are the primary storage while capacitances are used to avoid deep discharging of the battery and as a backup storage. In this research, supercapacitors are used alternatively and can able to function as a primary storage beginning. The developed system was built on the electric bike and consequences were gathered. A determination circuit is needed because the design is capable in increasing the liberty of electric vehicles to avoid high current extremum and fast discharges of the batteries. The research unfastened doors for future work such as bettering power circuit to increase efficiency and analyze the liberty by changing the function of the battery and supercapacitor. Coates and Charkey ( 2002 ) states that batteries proving on Sealed Nickel-Zinc Batteries are conducted for electric bike appli cations because it provides the same sum of energy with half the weight comparison to the standard lead-acid batteries. Hsu, et al. , ( 2011 ) poses a solution to supply comfort and safety step in different types of Pedelecs siting environment while optimising the public presentation of the battery. The quality of siting conditions can be improved by get the better ofing three forces of nature, air retarding force, clash and hill retarding force. The key to the solution is the bicycling power and entire power of the needed power should be changeless and sufficient extra power is provided to get the better of any of the three forces. The design is besides able to work out instability job in Pedelecs when the motor suddenly occurs by maintaining the instantaneous acceleration of the aided power be kept within the Safety Zone and Comfort Zone. Real environment simulation scenarios were conducted on different route types and pedal force in urban countries. Consequences confirms the design has better energy use comparison to bing conventional and delta acquisition regulation based assisted power methods. T he study provides room for farther research on work outing the method to automatically set the motor to the different type of physical conditions of the riders. After the rating of all the 11 diaries, it can be concluded that most of the diaries focuses on work outing the jobs presently faced by electric bike that provide deficient energy in the battery storage and deficient power aid. There are ample room for farther development on electric bikes and Pedelecs because it engineering is comparatively new. Further research done on this country would profit societies populating in urban country to be used as a signifier of environmental friendly transit as opposed to conventional autos and bikes.Problem StatementBased on old research done on electric bikes, most surveies concur that the depletion of crude oil and the rise in the emanation of nursery gasses are the factor that contribute to the promotion of electric bikes ( Brand & A ; Ertugrul, 2007 ; Hsu, et al. , 2011 ; Indulal & A ; Nair, 2007 ; Morchin, 1998 ; Nagendran & A ; Senthil, 2010 ; Sousa, et al. , 2007 ; Xiong, et al. , 2010 ) . In malice of this, there are still plenty of room fo r farther development and sweetening in the country of electrical bikes. The battery storage system incorporated in electric bikes provides deficient energy for long distance travels and does non transport self-charging capablenesss ( Coates & A ; Charkey, 2002 ; Nagendran & A ; Senthil, 2010 ) . Electric assisted bikes or Pedelecs confront jobs such as an disconnected drive force when the motor is triggered ( Hsu, et al. , 2011 ) .Undertaking BackgroundThe undertaking focuses on bettering the overall public presentation of electric aided bike or Pedelecs. Since there is a demand on electric bikes, it would be good for society and concern organisation to inscribe the development of Pedelecs. In a study by Time News, most electric bikes run on lead-acid batteries and are unsuitable for the lifting demands of day-to-day transit ( Ramsy, 2009 ) . Numerous solutions were established by assorted applied scientists and organisations to counter these jobs. Some research workers focus on th e regeneration of electricity from external beginnings ( Somchaiwong & A ; Ponglangka, 2006 ; Xiong, et al. , 2010 ) . While some dressed ore on utilizing typical signifiers of power direction ( Brand & A ; Ertugrul, 2007 ; Hsu, et al. , 2011 ; Morchin, 1998 ; Nagendran & A ; Senthil, 2010 ) . For the proposed Regenerative Battery for Pedelecs undertaking, it confronts both of these methods to work out the battery jobs that arise from conventional electrical bike. In add-on to replacing autos to cut down the emanation of nursery gasses, the regenerative power during a worsening gradient reduces the dependence on electricity. The coevals of electricity from Independent Power Producers ( IPP ) indirectly affect the environment. For case, the building of Hydroelectric Plant requires big countries peculiarly in distant countries and significant measures of fossil fuels are used to power up machineries ( McKinney, et al. , 2007 ) . The natural home ground, place to both vegetations and z oologies would be destroyed in the procedure. The proposed regenerative power is designed to cut down the power ingestion in the battery storage while supplying rechargeable power supply at the same clip. The regenerative power incorporated in the design would be able to work out issues associating to the deficient power in the battery storage system. It would be able to spread out the life rhythm of the battery for longer distance travels. Most electric bike proprietors today complain that electric bikes do non supply sufficient power aid. The latest Pedelecs today has power-assistance during hill mounting or on irregular surface roads to supply the extra encouragement without holding the rider to exercise much force. However, Hsu, et al. , ( 2011 ) states that there are deficient power aid to get the better of three forces, air retarding force, clash and hill retarding force. Air retarding force and clash does non necessitate much power comparison to hill retarding force. The moto r of the power aid provides adequate force to get the better of hill retarding force, clash or air drag while the bicycling power by the rider remains changeless. This would be enable riders to conserve energy for longer equitation. Most seniors find that conventional bikes are strenuous and unsafe. Therefore, some seniors would instead remain in the comfort of their places without acquiring much exercising and fresh air. Pedalecs would be able to promote seniors to get the better of their fright towards conventional bikes. In urban town countries, acquiring out purchasing some food markets would sometimes be a fuss particularly if the food market store is non within walking distance. Most people today would instead drive their auto out to purchase some fruits and veggies or to bring the day-to-day newspaper. It is a really unhealthy wont that began to attest among the town citizens. Little did they know that acquiring fresh air by cycling or taking a day-to-day amble would better the wellbeing of the individual and reduces wellness hazard such as diabetes and cardiovascular disease. Harmonizing to a Congressional Report, less than one trip in one hundred per centum is by bike ( Congress, 2002 ) . The study besides mentioned that frequent motorcycle trips would besides bring around the dependence of tobacco users and alkies. Regenerative braking in electric bikes is deriving popularity excessively. The Panasonic Vivi RX 10-S characteristics a braking system that recharges a 10AH Li-ion secondary hitter located following to rise up wheel of the bike ( Toto, 2008 ) . Liu, et al. , ( 2008 ) mentioned that braking control can be used to change over mechanical energy to electric energy by bettering battery life-span. Using the same theory, the proposed design is able to do usage of hilly countries to bring forth electricity. Since no energy is needed for bike traveling downhill, the bike still moves downwards due to the forces of gravitation. For certain instances, with the regenerative power, braking is non required because the regenerator is able to cut down the velocity of the overall bike while traveling downhill.MethodologyThe range of this research is divided into five phases. The clip range of the undertaking is expected to be completed in 9 months. Research At the beginning of the Final Year Undertaking, intensive research on the country of electric bikes must be done before designing of the undertaking takes topographic point. Research would be an explanatory research in the beginning to obtain an overview on the research country and to detect options to the research aim. Evaluation on other research documents done to place the new developments in engineering and suites for farther surveies is noted. Solutions can be developed by admiting the job faced by the society today. Qualitative Research such as studies and Questionnaires can be conducted to place the current job faced for farther development. This is of import because the success of a merchandise is determined by run intoing the demand of society today. Brainstorming Sessionss are required after the gathered information is evaluated to find the feasibleness of the undertaking and to get assorted options to the job. This phase is expected to finish within a month. Design The designing procedure takes topographic point after the rating of the collected information is finalised. A basic construct should be achieved at this phase. All the cognition on mechanics, electronics and scheduling is required to plan the proposed thought. Computer simulations are to be usage to design and prove the feasibleness of the thought. Autodesk Inventor can be used to build the model and supply a ocular overview of the bike. Matlab and Labview can be used in the scheduling development of the regenerative power system. Computer simulations are used before the building of the bike to virtually imitating the design while cut downing unneeded outgo. This phase is expected to finish in 2 months. Execution The execution phase involves constructing the paradigm based on the finalized design. A conventional bike is required as the chief construction of the design. Motor, Lithium Ion Battery and Transmission System is needed to modify the bike into an electrical-assisted bike. Torque Sensors, Slope Sensors or Tilt Sensors are installed to feel when the motor is needed. The Slope or Tilt Detectors can be replaced by Apple Application known as Gyroscope for an excess appealing characteristic. Additional hardware such as a state-of-charge index, power check hub and throttle switch can be added subsequently on. This phase is expected to finish in 3 months. Testing The proving stage involves the practical appraisal on the now to the full built bike. Assorted trials would be performed to find the public presentation of the full system. Two types of proving can be conducted, laboratory testing and field testing. Laboratory proving involves a set of variables such as power, efficiency, rhythm velocity, life-span of the rechargeable battery and the motor. For field testing, a laptop with a PCMIA card is incorporated to the system to get the information. The proving would affect around 20 voluntaries from different age group, gender, weight and physical fittingness degree. All voluntaries have to travel through a predetermine way with different type of terrain in an urban country. The laptop is used to enter informations such as bicycling torsion, bike velocity and applied power. The information collected is to be used to measure the public presentation of the system. A set of feedback signifiers could be given out at the terminal of the proving to estimate the satisfactory degree of each voluntary towards the system. This phase is expected to finish in 2 months. Report Report authorship is to be conducted at the terminal of all the four phases. The range and design procedure in constructing the system are to be complied. The information collected are tabulated in graph and figures to exemplify the results. This phase is expected to finish within month. Restrictions There is some restriction that would be encountered in the procedure of implementing the system. Budget constrain would be a factor due to the dearly-won hardware needed to build the bike. A life-size paradigm is more appropriate because a smaller-scale paradigm would non be functioning its intent. In a newspaper study by The Star, due to safety issues, electric bikes may be taken off the route if the Cabinet accepts a recommendation from the Transport Ministry ( Kong, 2011 ) . If the amendment of censoring electric bike is implemented throughout the state ; it may besides impact the field-testing of the system.Research AimsThis survey embarks on the undermentioned aims: To bring forth an environmental friendly transit as an option to petrol ingestion autos To work out instability issues affecting the disconnected acceleration when the motor is turned on To supply an alternate regenerative power on worsening inclines to lengthen the life-span of the battery storage system To better the overall public presentation to Pedelecs that are available in the market today To plan a signifier of transit for suited in dense populated urban countriesResearch QuestionWhat are the current impact on the environment and ways to work out the job? What are the current issues faced by electric bike? What add-on or alternate regenerative power can be installed to conventional electric bikes? What can be done to appeal to the market section to purchase the merchandise? How to work out issues affecting unhealthy wonts of the society by trusting on autos for short distance travels?Significance of the UndertakingThe proposed regenerative bike would be able to function as a stepping rock for farther development on electric assisted bikes. Surveies by other researches can be done by mentioning of the design system used and the information collected. Restrictions and jobs identified can be solved by future research. The proposed design hopes to significantly cut down the emanation of nurseries gasses emitted by gasoline goaded autos. If the design meets the demands of the society, industries would get down bring forthing more electrical assisted-bicycle which in return, reduces the market monetary value of the system to make out to all sections of the society.Expected ConsequencesThe expected result of this undertaking is to successfully develop a working existent size electrical aid bike paradigm capable of change overing mechanical energy to electrical energy. From the undertaking, fresh theories can be established that would indirectly profit other countries of scientific disciplines. Furthermore, the theories presented would take to implementation for future possible applications. The tabular matters of informations collected from the undertaking is to besides promote possible research workers particularly budget constrain research workers to prosecute in the country of electric powered vehicles. A stable managing electrical assisted bike is expected to be built to supply safe and comfy siting experience. In return, physically fit or unphysical tantrum riders would be able to make full the joy of siting a bike for going or recreational usage. The design and engineering incorporated in the undertaking is expected to appeal to the society and supply as an option to autos and bikes. This would straight cut down C footmark and slower the procedure of planetary heating.

Earning a College Degree Essay

Earning a college degree has always been a very important goal of mine. My children are getting older and in a few short years will start looking into college themselves. It became more important for me now than ever to make my dream, my goal, a reality. There were many factors that came into play when I decided that this was the right time in my life to return to school. Being a non-traditional student, cost, flexibility, and accreditation were among the most important factors for me when choosing an online university. As my research into finding the right university continued, I found that Western Governors University had much more to offer their students than just an education. The financial aspect of returning to school was probably my biggest concern. I wanted to earn a degree, but didn’t want to be left with a hefty student loan payment at the end. Many of the online University’s that I looked into were â€Å"for profit† schools. Being inexperienced and new to this research I didn’t realize that there was such thing as a â€Å"non for profit† online University until I stumbled upon WGU. With affordable tuition, I knew that my dream could soon become reality. My children and husband are my number one priorities. They always have been, always will be. My time spent with them is precious and something that I would not give up for anything. The flexibility in classes and coursework that WGU offers has given me the perfect balance to be both a mother and a student. Since WGU is a competency based school, this allows me to spend less time on the material that I already know and concentrate more on the subjects that I am not as familiar with. Accreditation was another important factor for me. I didn’t want to spend the next 3 to 4 years going to school, spending countless hours reading and studying, only to find out that future employers would not take my degree seriously. Finding out that WGU is highly respected among businesses made my decision that much easier. There have been a few unexpected surprises along my journey thus far, with WellConnect being one of them. I never realized how much an online university could care about the health and wellbeing of their students. WGU also has some great mentors who not only offer encouragement, but push you to do the best and be the best that you can be. From my first inquiry of Western Governors University to now, I can say that, without a doubt, I made the right decision. I have finally found an online university who is just as committed to my success as I am. I would encourage anyone thinking about  returning to school as a non-traditional student to look no further than Western Governors University. With their low-cost tuition, flexibility, and accreditation to their amazing and caring mentors and their competency based program, WGU is definitely a perfect fit.